Le portail a été désactivé. Veuillez contacter l'administrateur de votre portail.

Fiche explicative de la leçon : Code génétique Biologie

Dans cette fiche explicative, nous allons apprendre à décrire la nature du code génétique et à rappeler comment les informations sont transférées de l’ADN aux protéines.

Le génome humain est fait de 3,1 milliards de paires de bases et est entassé dans la plupart des cellules de notre corps. Cet ADN est responsable de tous nos caractères physiques, comme la couleur de nos cheveux, la taille de nos mains et même la façon dont nous percevons le goût de certains aliments!Si vous n’aimez pas la coriandre, c’est peut-être parce que vous avez une variation dans un gène du récepteur olfactif qui vous donne l’impression que les aldéhydes dans les feuilles de coriandre ont un goût fortement savoneux!Tous ces caractères sont basés sur la séquence d’ADN des gènes concernés, et une fois que ce gène est exprimé, il produit une protéine spécifique qui donnera ce caractère particulier. En d’autres mots, le gène des cheveux roux sera transformé en une protéine des cheveux roux qui rendra vos cheveux roux!

Terme clé: Caractère (Attribut)

Un caractère est un attribut observable et héréditaire d’un organisme.

La question est la suivante:comment ces séquences d’ADN sont-elles interprétées pour nous donner toutes ces merveilleuses protéines et les caractères correspondants?

Il existe plusieurs étapes pour passer d’une séquence d’ADN à une protéine qui exprime le caratère associé. Ces étapes sont collectivement appelées le « dogme central de la biologie moléculaire », et elles décrivent comment un gène passe d’un ADN à la séquence protéique correspondante. Regardons ce processus plus en détail en utilisant l’exemple de l’insuline, une protéine impliquée dans la régulation des niveaux de glucose dans le corps.

Terme clé: Gène

Un gène est un segment d’ADN qui contient les informations nécessaires pour produire une unité fonctionnelle, par exemple une protéine. C’est l’unité fonctionnelle de l’hérédité.

La première étape consiste à indiquer à la cellule que l’insuline doit être fabriquée, qui peut se traduire par une augmentation des taux de glucose. Il y a des dizaines de milliers de gènes dans le génome humain, et dans cet exemple, seule la protéine pour l’insuline et aucune autre est nécessaire. La demande spécifique de production d’insuline est donnée par des signaux que la cellule reçoit. La cellule crée ensuite un message pour fabriquer de l’insuline dans un processus appelé transcription, au cours duquel une copie du gène est produite qui peut sortir du noyau pour se transformer en une protéine. Ce message est appelé l’ARN messager (ARNm). Pour simplifier, l’ARNm de l’insuline contient les mêmes informations que celles dans le gène de l’insuline, sauf que l’ARN est simple brin et non double brin comme l’ADN. Comme il est sous forme de simple brin, l’ARN est moins stable que l’ADN et peut se dégrader plus facilement. Ceci est une caractéristique importante de l’ARNm et est exploitée pour réguler ses niveaux dans la cellule. Un schéma simplifié de la transcription est illustré à la figure 1.

Terme clé: ARNm (ARN messager)

L’ARNm est un message qui est transcrit à partir de l’ADN d’un gène et qui peut être traduit pour fabriquer la protéine correspondante.

Terme clé: Transcription

La transcription est le processus de conversion d’une séquence d’ADN en ARNm.

Une fois que l’ARNm de l’insuline est produit par la transcription, l’étape suivante consiste à le transformer en une protéine d’insuline. Les instructions pour construire la protéine insuline se trouvent dans l’ARNm de l’insuline, et il suffit juste que l’ARNm soit traduit en une séquence linéaire d’acides aminés. La traduction se produit à l’intérieur d’une structure macromoléculaire appelée le ribosome. Les acides aminés sont incorporés en utilisant des molécules d’ARN spécialisées appelées ARN de transfert et sont liés entre eux pour former une chaîne polypeptidique. C’est ce que montre la figure 2.

Terme clé: Traduction

La traduction est le processus de conversion d’une séquence d’ARNm en un polypeptide qui peut se replier en une protéine.

Définition: Acide aminé

Les acides aminés sont les monomères individuels qui forment ensemble une protéine.

Définition: Protéine

Une protéine est une macromolécule biologique complexe, composée de monomères d’acides aminés, qui peut avoir une grande variété de formes et de fonctions.

Selon la nature des charges positives et négatives dans les acides aminés individuels, la chaîne polypeptidique peut ensuite se replier en une forme spécifique pour donner à la protéine sa forme et sa fonction spécifiques.

Ainsi, le « dogme central de la biologie moléculaire », qui est illustré à la figure 3, se compose de ces deux concepts:la transcription et la traduction. Ce processus décrit comment l’ADN d’un gène spécifique est transcrit en ARNm puis traduit en la protéine correspondant spécifiquement à ce gène.

Ce concept du « dogme central de la biologie moléculaire » se comprend mieux si vous imaginez un client dans un restaurant qui commande à manger. Le menu, dans cette analogie, représente le génome et contient tous les gènes. Le client qui représente la cellule peut commander tout ce dont il a besoin en fonction de ses besoins spécifiques. Une fois qu’il passe une commande, celle-ci est écrite (ou transcrite en ARNm) et livrée au cuisinier pour être convertie en un repas (ou traduite en la protéine correspondant au gène). Puisque le génome contient tellement d’informations, il est important de mettre en place un système pour préciser quels gènes doivent être exprimés sous forme de protéine. Et les cellules, comme les personnes qui commandent avec un menu, ont des besoins spécifiques en fonction de leur situation.

Exemple 1: Comprendre le dogme central de la biologie moléculaire

Le diagramme ci-dessous schématise le dogme central de la biologie moléculaire.

  1. Quel procédé a été remplacé par X?
    1. la transcription
    2. la mitose
    3. la traduction
    4. la synthèse
    5. la méiose
  2. Quel procédé a été remplacé par Y?
    1. la synthèse
    2. la mitose
    3. la transcription
    4. la méiose
    5. la traduction

Réponse

L’ADN dans nos cellules détient les instructions pour construire toutes les protéines qui composent notre corps. Ces instructions se présentent sous la forme de gènes. Pour qu’un gène de l’ADN soit converti en protéine, un ARN messager (ARNm) doit d’abord être formé dans un processus appelé transcription. La transcription produit une séquence d’ARNm qui porte la même information que celle qui se trouve dans l’ADN du gène, mais comme il s’agit d’ARN, la séquence comprend de l’uracile (U) à la place de la thymine (T). Cette séquence d’ARNm peut ensuite être traduite en acides aminés pour former un polypeptide dans un processus appelé traduction. Le polypeptide résultant peut ensuite se replier pour former la protéine correspondant au gène.

Partie 1

Sur la figure, nous pouvons voir une séquence d’ADN qui se convertie en ARNm;c’est la première étape du dogme central de la biologie moléculaire, appelée la transcription. Par conséquent, la bonne réponse est A:la transcription.

Partie 2

Sur la figure, nous pouvons voir une séquence d’ARNm qui se convertie en une chaîne polypeptidique d’acides aminés;c’est le processus de traduction. Par conséquent, la bonne réponse est E:la traduction.

Relation: Dogme central de la biologie moléculaire

ADNARNmprotéine

Nous savons qu’il existe 20 acides aminés différents impliqués dans la synthèse des protéines. Nous savons également qu’il y a 4 nucléotides dans l’ADN et l’ARN. Alors, comment le code génétique de cette séquence nucléotidique est-il traduit en ces 20 acides aminés?

S’il n’y avait besoin que d’un seul nucléotide pour le code génétique (A, C, G, U), alors il n’y aurait que 4 possibilités différentes d’acides aminés. S’il n’y avait besoin que de deux nucléotides dans le code génétique, alors nous aurions 4=16 différentes possibilités, ce qui n’est toujours pas suffisant. Avec trois nucléotides, on a 4=64 différentes combinaisons, ce qui est plus que suffisant pour les 20 acides aminés observés. Par conséquent, la taille du code génétique est de 3 nucléotides minimum.

En utilisant le code génétique, une séquence d’ADN comme GAATTAGGCAGTGGGATTTAGCCA peut facilement être transformée en acides aminés.

Le code génétique est un ensemble de règles déterminant la façon dont les nucléotides sont traduits en acides aminés spécifiques. Le code génétique stipule que trois nucléotides, ou un codon, déterminent l’acide aminé spécifique à inclure dans la protéine.

Ainsi, notre exemple précédent de la séquence d’ADN GAATTAGGCAGTGGGATTTAGCCA peut être convertie en ARNm par la transcription (et en remplaçant la thymine (T) par de l’uracile (U)):CUUAAUCCGUCACCCUAAAUCGGU qui peut ensuite être divisée en 8 ensembles de codons:CUUAAUCCGUCACCCUAAAUCGGU.

Chacun de ces codons fait référence à un acide aminé spécifique donné par le code génétique.

Terme clé: Code génétique

Le code génétique est formé par la séquence de bases azotées dans un brin de molécule d’ARN messager (ARNm) qui est synthétisé à partir de l’ADN et code les informations nécessaires à une cellule pour synthétiser des protéines spécifiques.

Définition: Codon

Un codon est une séquence de trois nucléotides d’ADN ou d’ARN qui correspond à un acide aminé spécifique.

Vous remarquerez peut-être que lorsque la séquence d’ADN est divisée en codons, il n’y a pas de chevauchement.

Le code génétique est non chevauchant, ce qui signifie que les bases de chaque codon ne sont utilisées qu’une seule fois. Ainsi, une séquence d’ARNm « AUGGGACCU » est traduite en 3 codons non chevauchants comme indiqué sur la figure 4.

Mot clé: Non chevauchant

Le code génétique est non chevauchant, ce qui signifie que le code génétique est traduit en groupes de trois, et une base n’est pas réutilisée une seconde fois pour traduire un codon.

Exemple 2: Comprendre les règles du code génétique pour lire les codons

Un étudiant lit la séquence suivante de bases d’ARNm:UACGAGAACCGA. Il la divise en codons suivants:UACG AGAA CCGA. Quel est le problème avec cette suite de codons?

  1. Les codons se chevauchent.
  2. Les codons ne comportent que 3 bases.
  3. Les codons doivent être lus comme des bases d’ADN.
  4. Il n’y a pas de problème;cette séquence est correcte.

Réponse

Pour qu’un gène de l’ADN soit converti en protéine, un ARN messager (ARNm) doit d’abord être formé dans un processus appelé transcription. La transcription produit une séquence d’ARNm qui porte la même information que celle qui est dans l’ADN du gène, mais il s’agit de l’ARN, donc elle comprend de l’uracile (U) à la place de la thymine (T). Cette séquence d’ARNm peut ensuite être traduite en acides aminés pour former un polypeptide dans un processus appelé traduction. Le polypeptide résultant peut se replier pour former la protéine correspondant au gène.

Afin de traduire l’ARNm en protéine, la séquence de nucléotides dans l’ARNm est convertie en acides aminés grâce au code génétique. Des séquences de trois bases, appelées des codons, correspondent à des acides aminés spécifiques. Par exemple, le codon dans l’ARNm « GGG » code pour l’acide aminé glycine lors de la traduction. Ces codons sont non chevauchants, ce qui signifie qu’une base n’est pas réutilisée une seconde fois dans une séquence spécifique. Ainsi, GGGUAA correspondrait à GGG UAA et ne recommencerait pas à partir du deuxième G (donc, pas GGG GGU GUA).

La séquence UACGAGAACCGA dans cet exemple serait donc traduite par les codons UAC GAG AAC CGA. L’exemple UACG AGAA CCGA regroupe les codons en 4 bases, ce qui est incorrect.

Par conséquent, la bonne réponse est B:les codons ne comportent que 3 bases.

Dans le code génétique, chaque codon identifie une protéine spécifique. Par exemple, la séquence d’ADN « ATG » est un codon qui code pour l’acide aminé méthionine. Rappelez-vous que c’est l’ARNm qui est traduit, et non l’ADN, donc le codon « ATG » serait en fait lu comme « AUG » pendant la traduction, car l’uracile (U) dans l’ARN remplace la thymine (T) dans l’ADN.

Sur la figure 5, nous pouvons voir comment les différents codons peuvent être traduits pour coder 20 acides aminés.

Donc, si vous avez la séquence d’ARNm AUGGGGUCU, les codons correspondants seront AUG-GGG-UCU, qui se traduisent par Met-Gly-Ser.

Vous remarquerez sur la figure 5 qu’il y a une redondance (aussi appelée dégénérescence) dans le code génétique, ce qui signifie que certains acides aminés sont codés par plusieurs codons. L’arginine (Arg) peut être codée par 4 codons différents:CGG, CGA, CGC et CGU, tandis que la méthionine (Met) ne peut être codée que par un codon, AUG.

Terme clé: Dégénéré

Le code génétique est dégénéré, ou redondant, car certains des acides aminés peuvent être traduits à partir de différents codons.

Exemple 3: Utiliser une roue de codons pour déterminer une séquence d’acides aminés

Une séquence d’ADN est transcrite en une séquence d’ARN. Cette séquence d’ARN se lit 5-GCUUUCACGCAC-3

Utilisez la roue de codons pour déterminer la séquence des acides aminés.

  1. Arg, Ser, Thr, Pro
  2. Ser, Leu, Ala, His
  3. Ala, Phe, Thr, His
  4. Ser, Leu, Ala, Gln
  5. Ala, Leu, Thr, Gln

Réponse

Pour qu’un gène dans l’ADN soit traduit en protéine, un ARN messager (ARNm) doit d’abord être formé dans un processus appelé transcription. La transcription produit une séquence d’ARNm qui porte la même information que celle qui est dans l’ADN du gène, mais comme il s’agit de l’ARN, il inclut de l’uracile (U) à la place de la thymine (T).

Afin de traduire l’ARNm en protéine, la séquence de nucléotides dans l’ARNm est convertie en acides aminés selon le code génétique. Des séquences de trois bases, appelées codons, correspondent à des acides aminés spécifiques. Par exemple, le codon dans l’ARNm « GGG » code pour l’acide aminé glycine lors de la traduction. Ces codons sont non chevauchants, ce qui signifie que qu’une base n’est pas réutilisée une seconde fois dans une séquence spécifique. Ainsi, GGGUAA correspondrait à GGG UAA et ne recommencerait pas à partir du deuxième G (donc, pas GGG GGU GUA).

Une roue de codons, comme indiqué ci-dessus, est le code génétique pour les codons et l’acide aminé correspondant. Pour l’utiliser, partez du centre de la roue (à l’extrémité 5) vers l’extérieur (vers l’extrémité 3). Vous devez vous souvenir que par convention les séquences d’ARNm sont lues dans le sens 5 vers 3. Ainsi, pour le codon 5-GAG-3, vous commencez par le centre de la roue de codons en choisissant « G », puis « A » dans la zone suivante, et enfin « G » dans la dernière zone. Cela donne l’acide aminé Glu.

La séquence fournie 53-GCUUUCACGCAC- peut être divisée en codons en se terminant par le troisième nucléotide, ce qui correspond aux codons GCU UUC ACG CAC. Voyons comment se traduit chaque codon en son acide aminé. En utilisant la roue de codons et en partant du centre de la roue pour « GCU », focalisez-vous sur le quadrant G, et avancez vers le C, puis terminez avec le U sur le bord du cercle. Vous pouvez voir que cela correspond à Ala (ou alanine). Pour les codons restants,

  • UUC correspond à Phe,
  • ACG correspond à Thr,
  • CAC correspond à His.

Par conséquent, la bonne réponse est C:Ala, Phe, Thr, His.

Dans la majorité des cas, le code génétique est le même code utilisé par tous les êtres vivants sur Terre. Ainsi, « GGG » code toujours pour la glycine que ce soit chez les Bactéries ou chez les Hommes - c’est universel!

Terme clé: Universel

Le code génétique est universel, ce qui signifie qu’il s’applique à tous les organismes sur Terre qui se reproduisent par le biais de l’ADN.

Exemple 4: Caractéristiques du code génétique

Lequel des énoncés suivants décrit correctement les caractéristiques du code génétique?

  1. Il est dégénéré, spécifique à l’organisme et non chevauchant.
  2. Il est dégénéré, universel et non chevauchant.
  3. Il est universel, spécifique à l’organisme et non répétitif.

Réponse

Pour qu’un gène de l’ADN soit converti en protéine, un ARN messager (ARNm) doit d’abord être formé dans un processus appelé transcription. La transcription produit une séquence d’ARNm qui porte la même information que celle qui est dans l’ADN du gène, mais comme il s’agit de l’ARN, il inclut de l’uracile (U) à la place de la thymine (T). Cette séquence d’ARNm peut ensuite être traduite en acides aminés pour former un polypeptide dans un processus appelé traduction. Le polypeptide résultant peut se replier pour former la protéine correspondant au gène.

Afin de traduire l’ARNm en protéine, la séquence de nucléotides dans l’ARNm est convertie en acides aminés grâce au code génétique. Des segments de trois bases, les codons, correspondent à des acides aminés spécifiques. Par exemple, le codon dans l’ARNm « GGG » code pour l’acide aminé glycine pendant la traduction. Le code génétique a trois caractéristiques:

  1. Il est dégénéré ou redondant, ce qui signifie qu’un acide aminé peut être traduit à partir de plusieurs codons.
  2. Les codons sont non chevauchants, ce qui signifie que qu’une base n’est pas réutilisée une seconde fois dans une séquence spécifique. Ainsi, GGGUAA correspondrait à GGG UAA et ne recommencerait pas à partir du deuxième G (donc, pas GGG GGU GUA).
  3. Il est universel, ce qui signifie que le code génétique est utilisé par tous les organismes sur Terre pour fabriquer des protéines à partir d’ARNm. Ce n’est pas spécifique à un organisme.

Par conséquent, la bonne réponse est B:il est dégénéré, universel et non chevauchant.

Le code génétique étant universel, il est donc possible de comparer les séquences d’acides aminés des protéines à travers toutes formes de vie. Pour comparer les séquences d’acides aminés entre les espèces, les séquences sont alignées. Ces alignements de séquence peuvent ensuite dévoiler des changements entre les espèces.

Par exemple, la séquence protéique de l’insuline peut être alignée pour faire ressortir les similitudes et les différences entre les Poules, les Hommes et les Chimpanzés!Les parties de la séquence protéique qui sont conservées ont tendance à se trouver dans des régions cruciales pour le fonctionnement de la protéine, ce qui peut nous donner des indices sur le fonctionnement de la protéine. Nous pouvons même utiliser cette information pour en savoir plus sur l’évolution ou les variations des protéines au cours du temps, afin de déterminer les relations évolutives entre les organismes.

Sur la figure 6, les séquences d’acides aminés de l’insuline chez les Poules, les Hommes et les Chimpanzés sont alignées afin de les comparer. En alignant ces protéines, nous pouvons voir où se trouvent les différences, et plus il y a de différences, plus leur ancêtre commun est éloigné. Observez la similitude de l’insuline entre l’Homme et le Chimpanzé (seul un acide aminé diffère) par rapport à la protéine de l’insuline d’une poule (environ 10 différences). D’après ces données, les scientifiques pourraient déduire que le lien de parenté entre les Poules et nous est plus éloigné qu’avec les Chimpanzés, car il y a plus de différences (mutations) avec l’insuline de la Poule qu’avec celle du Chimpanzé. Cela s’explique par le fait que les mutations se produisent sur une longue période de temps.

Récapitulons certains des points clés que nous avons couverts dans cette fiche explicative.

Points clés

  • Le dogme central de la biologie moléculaire est que l’ADN est transcrit en ARNm qui est ensuite traduit en protéine.
  • La séquence d’ARNm est divisée en codons qui correspondent à des acides aminés spécifiques selon le code génétique.
  • Le code génétique est non chevauchant, est lu en séquences de 3 nucléotides à la fois et est dégénéré (redondant).
  • Le code génétique est universel et est commun entre tous les êtres vivants sur Terre, et pour cette raison, les séquences des protéines peuvent être alignées pour montrer les changements évolutifs au cours du temps.

Nagwa utilise des cookies pour vous garantir la meilleure expérience sur notre site. En savoir plus sur notre Politique de Confidentialité.