شارح الدرس: الشفرة الوراثية الأحياء

في هذا الشارح، سوف نتعلَّم كيف نَصِف طبيعة الشفرة الوراثية، ونذكر كيفية انتقال المعلومات من الحمض النووي (DNA) إلى البروتين.

يبلغ طول جينوم الإنسان 3.1 مليارات زوج من القواعد، ويُوجَد في صورة مكثَّفة داخل معظم خلايا الجسم. يمثِّل هذا الحمض النووي (DNA) جميع الخواصِّ الفيزيائية، مثل لون الشعر، وحجم اليدين، حتى الطريقة التي نتذوَّق بها أغذية معيَّنة. إذا كنتَ لا تحبُّ الكزبرة، فقد يرجع ذلك إلى وجود اختلاف أو تغيُّر في جين مُستقبِلات الشمِّ لدَيْك يجعلك تلاحِظ مذاق الألدهيدات القوي، الذي يُشبِه الصابون، في أوراق الكزبرة. تعتمد جميع هذه الصفات على تتابع DNA للجينات الخاصَّة بها، وبمجرد التعبير عن هذه الجينات، تُنتِج بروتينات متخصِّصة تُعطِي صفات محدَّدة. ببساطة يتحوَّل جين الشَّعر الأحمر إلى بروتين للشَّعر الأحمر، وهذا يمنحك شَعرًا أحمر.

مصطلح رئيسي: الصفة

الصفات هي الخواصُّ الظاهرية والموروثة لكائن حي.

السؤال هو: كيف يجري فكُّ شفرة تتابعات DNA لتعطينا كلَّ هذه البروتينات الرائعة والصفات المقابِلة لها؟

تُوجَد عدَّة خطوات للانتقال من تتابع DNA إلى بروتين يعبِّر عن الصفة المرتبطة به. وتمثِّل هذه الخطوات مجتمعة «الفكرة المحورية لعلم البيولوجيا الجزيئية»، وهي تَصِف كيف يتحوَّل الجين من DNA إلى تتابع البروتين المقابل له. لنتناول هذه العملية بمزيد من التفصيل باستخدام مثال الإنسولين، وهو بروتين يُشارِك في تنظيم مستويات السُّكَّر في الجسم.

مصطلح رئيسي: الجين

الجين مقطعٌ من الحمض النووي (DNA) يحتوي على المعلومات اللازمة لإنتاج وحدة وظيفية، مثل البروتين. وهو الوحدة الوظيفية للوراثة.

الخطوة الأولى هي إرسال إشارة إلى الخلية بأن ثمَّة حاجة لإنتاج الإنسولين، وهذا يَحدُث نتيجة لارتفاع مستويات الجلوكوز. تُوجَد عشرات الآلاف من الجينات في الجينوم البشري، لكنْ في هذا المثال، نحتاج إلى بروتين الإنسولين فقط. يُحدَّد طلب إنتاج الإنسولين بالإشارات التي تَستقبِلها الخلية. وبعد ذلك، تُنشِئ الخلية رسالةً لإنتاج الإنسولين من خلال عملية تُسمَّى النَّسْخ؛ حيث تتكوَّن نسخة من الجين، ثم تُغادِر النواة لكي تتحوَّل إلى بروتين. تُعرَف هذه الرسالة بالحمض النووي الريبوزي الرسول (mRNA). للتبسيط يحتوي mRNA الخاصُّ بالإنسولين على المعلومات نفسها الموجودة في جين الإنسولين، إلَّا أنه عبارة عن جزيء مفرد الشريط من RNA، وليس DNA المزدوج الشريط. ولأن RNA مفرد الشريط، فهو أقلُّ استقرارًا من DNA، ويُمكن أن يتحلَّل بسهولة أكبر. وهذه خاصية مُهِمَّة في mRNA تُساعِد في تنظيم مستوياته في الخلية. يوضِّح الشكل 1 صورة عامَّة مبسَّطة لعملية النَّسْخ.

مصطلح رئيسي: الحمض النووي الريبوزي الرسول (mRNA)

الحمض النووي الريبوزي الرسول (mRNA) عبارة عن رسالة منسوخة من الحمض النووي (DNA) لجين، ويُمكن ترجمتها لإنتاج البروتين المقابل.

مصطلح رئيسي: عملية النَّسْخ

النَّسْخ عمليةُ تحويل تتابع من الحمض النووي (DNA) إلى الحمض النووي الريبوزي الرسول (mRNA).

بمجرد إنتاج mRNA الخاصِّ بالإنسولين، تتمثَّل الخطوة التالية في تحويله إلى بروتين الإنسولين. تُوجَد تعليمات إنتاج بروتين الإنسولين في mRNA الخاصِّ بالإنسولين، وكلُّ ما نحتاجه هو ترجمة mRNA إلى تتابعٍ خطِّيٍّ من الأحماض الأمينية. تَحدُث عملية الترجمة داخل آلة وظيفتها تصنيع الجزيئات الحيوية الكبيرة، وتُعرَف باسم الريبوسوم. تُحمَل الأحماض الأمينية إلى الريبوسوم بواسطة جزيئات RNA متخصِّصة تُسمَّى الأحماض النووية الريبوزية الناقِلة (tRNA)، ويرتبط بعضها ببعض لتكوين سلسلة عديد الببتيد. وهذا موضَّح في الشكل 2.

مصطلح رئيسي: عملية الترجمة

الترجمة عمليةُ تحويل تتابعٍ من الحمض النووي الريبوزي الرسول (mRNA) إلى عديد ببتيد يُمكن أن يُطوَى لتكوين بروتين.

تعريف: الأحماض الأمينية

الأحماض الأمينية هي المونومرات المفردة التي ترتبط معًا لتكوين بروتين.

تعريف: البروتين

البروتين جزيءٌ حيويٌّ كبيرٌ مُعقَّدٌ، يتكوَّن من مونومرات الأحماض الأمينية، وله أشكال ووظائف متنوِّعة وواسعة النطاق.

نظرًا لوجود شحنة موجبة وشحنة سالبة داخل الأحماض الأمينية المنفردة، يُمكن طيُّ سلسلة عديد الببتيد في شكلٍ محدَّد لتكوين البروتين بشكله ووظيفته المحدَّدين.

ومن ثَمَّ، تستند «الفكرة المحورية لعلم البيولوجيا الجزيئية»، الموضَّحة في الشكل 3، إلى هذين المفهومين: النَّسْخ والترجمة. حيث تَصِف هذه العملية كيف يُنسَخ DNA الخاصُّ بجين معيَّن إلى mRNA، ثم يُترجَم إلى البروتين المقابل لهذا الجين.

ربما يتسنَّى لنا فهْم الفكرة المحورية لعلم البيولوجيا الجزيئية بشكلٍ أفضل إذا تخيَّلنا شخصًا يطلب الطعام في أحد المطاعم. في هذا التشبيه، قائمة الطعام تمثِّل الجينوم، وتحتوي على جميع الجينات. يَستطيع العميل، الذي يمثِّل الخلية، أن يطلب ما يَشاء حسب حاجته الخاصَّة. وبمجرد تقديم الطلب، يُكتَب (أو يُنسَخ في صورة mRNA) ويُنقَل إلى المطبخ لتحويله إلى الوجبة المطلوبة (أو لترجمته إلى البروتين المقابِل للجين). ولأن الجينوم يحتوي على الكثير من المعلومات، فمن الضروري وجود نظام لتحديد الجينات التي يجب التعبير عنها في صورة بروتينات. والخلايا شأنها شأن الأشخاص الذين يطلبون من قائمة الطعام، لها احتياجاتها الخاصَّة حسب حالتها.

مثال ١: فهْم الفكرة المحورية لعلم البيولوجيا الجزيئية

يوضِّح الشكل الآتي المُلخَّص الأساسي للفكرة المحورية لعلم البيولوجيا الجزيئية.

  1.  ما العملية التي يُشِير إليها الحرف (أ)؟
    1.  النَّسْخ
    2.  الانقسام الميتوزي
    3.  الترجمة
    4.  التخليق
    5.  الانقسام الميوزي
  2.  ما العملية التي يُشِير إليها الحرف (ب)؟
    1.  التخليق
    2.  الانقسام الميتوزي
    3.  النَّسْخ
    4.  الانقسام الميوزي
    5.  الترجمة

الحل

يحتوي DNA في الخلايا على تعليمات بناء جميع البروتينات المُكوِّنة للجسم. تُوجَد هذه التعليمات في صورة جينات. ولكي يُترجَم جين موجود في DNA إلى بروتين، يجب تكوين mRNA أولًا من خلال عملية تُسمَّى النَّسْخ. يَنتُج عن النَّسْخ تتابع من mRNA يَحمِل المعلومات نفسها الموجودة في الحمض النووي للجين، ولكنْ بما أنه عبارة عن RNA، يحتوي التتابع على اليوراسيل (U) بدلًا من الثايمين (T). يمكن بعد ذلك تحويل تتابع mRNA إلى أحماض أمينية لتكوين سلسلة من عديد الببتيد في عملية تُسمَّى الترجمة. ثم يُطوَى عديد الببتيد الناتج لتكوين البروتين المُقابِل للجين.

الجزء الأول

في هذا الشكل، نلاحِظ عملية تحويل تتابع من DNA إلى mRNA، وهي الخطوة الأولى ضمن الفكرة المحورية لعلم البيولوجيا الجزيئية، التي تُسمَّى النَّسْخ. ومن ثَمَّ، فالإجابة الصحيحة هي (أ): النَّسْخ.

الجزء الثاني

في هذا الشكل، نلاحِظ أيضًا عملية تحويل تتابع mRNA إلى سلسلة عديد ببتيد مكوَّنة من أحماض أمينية، وهي عملية الترجمة. إذن الإجابة الصحيحة هي (هـ): الترجمة.

علاقة: الفكرة المحورية لعلم البيولوجيا الجزيئية

DNAmRNAو

نعلم أنه يُوجَد 20 حمضًا أمينيًّا مختلفًا يُشارِك في عملية تخليق البروتينات. كما نعلم أنه تُوجَد أربعة أنواع من النيوكليوتيدات في DNA وRNA. إذن كيف تُترجَم الشفرة الوراثية التي يَحمِلها تتابع النيوكليوتيدات إلى الأحماض الأمينية الـ 20؟

إذا كانت الشفرة الوراثية مكوَّنة من نيوكليوتيدة واحدة (A، C، G، U)، فهذا يعني وجود أربعة أحماض أمينية مختلفة فقط. وإذا كانت الشفرة الوراثية مكوَّنة من نيوكليوتيدتين، سنحصل على 4=16 احتمالًا مختلفًا، وهذا ما يَزال غير كافٍ. لكن في وجود ثلاث نيوكليوتيدات، يصبح لدينا 4=64 من التوافيق المختلفة، وهذا أكثر ممَّا نحتاجه لتكوين شفرة لكلٍّ من الأحماض الأمينية الـ 20 المُكتشَفة. ومن ثَمَّ، فإن الحدَّ الأدنى لطول الشفرة الوراثية هو ثلاث نيوكليوتيدات.

وباستخدام الشفرة الوراثية، يُمكن تحويل تتابع حمض نووي مثل: GAATTAGGCAGTGGGATTTAGCCA بسهولة إلى أحماض أمينية.

الشفرة الوراثية مجموعةٌ من القواعد التي تحدِّد كيفية ترجمة النيوكليوتيدات إلى أحماض أمينية محدَّدة. وتنصُّ الشفرة الوراثية على أن ثلاث نيوكليوتيدات، أو الكودون، يحدِّد نوع الحمض الأميني المُشارِك في تكوين البروتين.

إذن تتابع الحمض النووي في المثال السابق: GAATTAGGCAGTGGGATTTAGCCA يُمكن تحويله إلى mRNA عن طريق نَسْخه، مع استبدال الثايمين (T) باليوراسيل (U): CUUAAUCCGUCACCCUAAAUCGGU ومن ثَمَّ يُمكن تقسيمه إلى ثمانية كودونات: CUUAAUCCGUCACCCUAAAUCGGU.

يُشير كلٌّ من هذه الكودونات إلى حمض أميني تُحدِّده الشفرة الوراثية.

مصطلح رئيسي: الشفرة الوراثية

تتكوَّن الشفرة الوراثية من تتابع القواعد النيتروجينية في شريط mRNA المنسوخ من DNA، وهي تُمثِّل شفرة للمعلومات اللازمة لتخليق بروتينات معيَّنة داخل الخلية.

تعريف: الكودون

الكودون تتابعٌ من ثلاث نيوكليوتيدات من DNA أو RNA يُقابِله حمض أميني معيَّن.

قد تلاحِظ أنه لا يَحدُث تداخُل عند تقسيم تتابع الحمض النووي إلى كودونات.

الشفرة الوراثية غير متداخِلة، وهو ما يعني أن القواعد في كلِّ كودون تُستخدَم مرَّة واحدة فقط. لذا يُترجَم تتابع mRNA مثل «AUGGGACCU» في صورة ثلاث كودونات غير متداخِلة، كما هو موضَّح في الشكل 4.

مصطلح رئيسي: عدم التداخُل

الشفرة الوراثية غير متداخِلة، بمعنى أن الشفرة الوراثية تُترجَم في مجموعات من ثلاث قواعد، ولا تُستخدَم نفس القاعدة مرَّتين أثناء ترجمة الكودون.

مثال ٢: فهْم قواعد الشفرة الوراثية لقراءة الكودونات

يقرأ طالبٌ التتابع الآتي لقواعد الحمض النووي الريبوزي الرسول (mRNA): UACGAGAACCGA. يقسمه إلى الكودونات الآتية: UACG AGAA CCGA. ما الخطأ الذي يتضمَّنه هذا التتابع من الكودونات؟

  1. تداخُل الكودونات.
  2. يجب أن يبلغ طول الكودونات ثلاث قواعد.
  3. يجب قراءة الكودونات باعتبارها قواعد للحمض النووي (DNA).
  4. لا يُوجَد خطأ؛ فهذا التتابع صحيح.

الحل

لكي يتحوَّل جين في DNA إلى بروتين، يجب تكوين mRNA أولًا في عملية تُسمَّى النَّسْخ. يَنتُج عن النَّسْخ تتابع من mRNA يَحمل المعلومات نفسها الموجودة في DNA الخاصِّ بالجين، ولكن بما أنه عبارة عن RNA، يحتوي التتابع على اليوراسيل (U) بدلًا من الثايمين (T). يُمكن بعد ذلك ترجمة تتابع mRNA هذا إلى أحماض أمينية لتكوين عديد ببتيد في عملية تُسمَّى الترجمة. ويُمكن أن يُطوَى عديد الببتيد الناتج لتكوين البروتين المقابِل للجين.

لترجمة mRNA إلى بروتين، يتحوَّل تتابع النيوكليوتيدات في mRNA إلى أحماض أمينية باستخدام الشفرة الوراثية. التتابعات المكوَّنة من ثلاث قواعد، التي تُسمَّى الكودونات، تُقابِلها أحماض أمينية محدَّدة. على سبيل المثال، الكودون «GGG» الموجود في mRNA يُشفِّر للحمض الأميني الجلايسين أثناء الترجمة. وهذه الكودونات غير متداخِلة، وهو ما يعني أن القاعدة نفسها لا تُستخدَم مرَّتين في تتابع محدَّد. إذن التتابع GGGUAA يُناظِر GGG UAA، ولن يتكرَّر من القاعدة G الثانية (أيْ إنه لا يُناظِر GGG GGU GUA).

إذن التتابع الموضَّح في هذا المثال UACGAGAACCGA سيُترجَم على أساس الكودونات UAC GAG AAC CGA. المثال UACG AGAA CCGA مكوَّن من مجموعات طول كلٍّ منها أربع قواعد، وهذا خطأ.

إذن الإجابة الصحيحة هي (ب): يجب أن يبلغ طول الكودونات ثلاث قواعد.

في الشفرة الوراثية، يُمثِّل كلُّ كودون حمضًا أمينيًّا معيَّنًا. على سبيل المثال، تتابع DNA «»ATG، هو كودون يُشفِّر للحمض الأميني الميثيونين. تذكَّر أن mRNA هو الذي يُترجَم، وليس DNA، لذلك سيُقرَأ الكودون «ATG» في صورة «AUG» أثناء الترجمة، لأن اليوراسيل (U) في RNA يحلُّ محلَّ الثايمين (T) في DNA.

في الشكل 5، يُمكننا أن نلاحِظ كيفية ترجمة الكودونات المختلفة إلى الأحماض الأمينية الـ 20.

إذن إذا كان لديك تتابع mRNA على النحو AUGGGGUCU، فالكودونات المقابِلة هي AUG-GGG-UCU، وهذا يُترجَم إلى Met-Gly-Ser.

ستلاحِظ في الشكل 5 وجود تكرار في الشفرة الوراثية، وهو ما يعني أن بعض الأحماض الأمينية يُمكن تشفيرها بعدَّة كودونات. فمثلًا، يُمكن تشفير الأرجينين (Arg) بأربعة كودونات مختلفة: CGG ،CGA ،CGC ،CGU، بينما يُشفَّر الميثيونين (Met) بكودون واحد فقط: AUG.

مصطلح رئيسي: التكرار

تُعرَف الشفرة الوراثية بأنها متكرِّرة؛ لأن بعض الأحماض الأمينية يُمكن ترجمتها من كودونات مختلفة.

مثال ٣: استخدام عجلة الكودونات لتحديد تتابع الأحماض الأمينية

يُنسَخ تتابع من الحمض النووي (DNA) إلى تتابع من الحمض النووي الريبوزي (RNA). يُقرأ هذا التتابع كالآتي 5- GCUUUCACGCAC-3

استخدِم عجلة الكودونات الموضَّحة لتحديد تتابع الأحماض الأمينية.

  1.  Arg, Ser, Thr, Pro
  2.  Ser, Leu, Ala, His
  3.  Ala, Phe, Thr, His
  4.  Ser, Leu, Ala, Gln
  5.  Ala, Leu, Thr, Gln

الحل

لكي يُترجَم جين في DNA إلى بروتين، يجب تكوين جزيء RNA الأول (mRNA) من خلال عملية تُسمَّى النَّسْخ. يَنتُج عن النَّسْخ تتابع من mRNA يحمل المعلومات نفسها الموجودة في DNA الخاصِّ بالجين، لكنه عبارة عن RNA؛ أيْ إنه يتضمَّن اليوراسيل (U) بدلًا من الثايمين (T).

لترجمة mRNA إلى بروتين، يتحوَّل تتابع النيوكليوتيدات في mRNA إلى أحماض أمينية باستخدام الشفرة الوراثية. التتابعات المكوَّنة من ثلاث قواعد، التي تُسمَّى الكودونات، تُقابِلها أحماض أمينية محدَّدة. على سبيل المثال، الكودون «GGG» الموجود في mRNA يُشفِّر للحمض الأميني الجلايسين أثناء الترجمة. وهذه الكودونات غير متداخِلة، وهو ما يعني أن القاعدة نفسها لا تُستخدَم مرَّتين في تتابع محدَّد. ولذا فإن GGGUAA يُناظِر GGG UAA، ولن يتكرَّر من القاعدة G الثانية (أيْ لا يُناظِر GGG GGU GUA).

تمثِّل عجلة الكودون، كما هو موضَّح سابقًا، الشفرة الوراثية للكودونات والأحماض الأمينية المقابِلة لها. لكي نَستخدِمها، نبدأ من مركز العجلة (الطرف 5) ثم نتَّجِه إلى الخارج (في اتجاه الطرف 3). تتذكَّر أن تتابعات mRNA تُقرَأ في الاتجاه 5 إلى 3 بحسب المُتعارَف عليه. إذن بالنسبة إلى الكودون 5-GAG-3 نتحرَّك خلال عجلة الكودونات بداية من المركز ونختار G، ثم A في المنطقة التالية، ثم G في المنطقة التالية. وهذا يُعطينا الحمض الأميني Glu (الجلوتاميك).

يُمكن تقسيم التتابع المُعطَى: 53-GCUUUCACGCAC- إلى كودونات بعد النيوكليوتيدة الثالثة، وهو ما يُعطينا الكودونات: GCU UUC ACG CAC. لنلقِ نظرةً على كيفية ترجمة كلِّ كودون إلى حمضه الأميني. باستخدام عجلة الكودونات والبدء من مركز العجلة لترجمة «GCU»، نركِّز على الرُّبع G، ثم نتحرَّك إلى الخارج إلى C، ثم أخيرًا إلى U عند الحافة الخارجية للدائرة. نلاحِظ أن هذا يُناظِر Ala (الألانين). بالنسبة إلى الكودونات المتبقِّية:

  •  UUC يُناظر Phe
  •  ACG يُناظر Thr
  •  CAC يُناظر His.

إذن الإجابة الصحيحة هي الخيار (ج): Ala, Phe, Thr, His.

في معظم الأحيان، تُستخدَم الشفرة الوراثية نفسها في جميع أشكال الحياة على الأرض. إذن الكودون «GGG» يُشفِّر دائمًا للجلايسين سواء في البكتيريا أو الإنسان؛ ومن ثَمَّ فهي شفرة عالَمية.

مصطلح رئيسي: عالَمية

الشفرة الوراثية عالَمية، بمعنى أنها تنطبق على جميع الكائنات التي تَستخدِم DNA باعتباره المادة الوراثية على كوكب الأرض.

مثال ٤: خواصُّ الشفرة الوراثية

أيُّ العبارات الآتية تَصِف خواصَّ الشفرة الوراثية؟

  1. مُتكرِّرة، ومُحدَّدة للكائن الحي، وغير متداخِلة.
  2. مُتكرِّرة، وعالَمية، وغير متداخِلة.
  3. عالَمية، ومُحدَّدة للكائن الحي، وغير مُتكرِّرة.

الحل

لكي يُترجَم جين موجود في DNA إلى بروتين، يجب تكوين جزيء RNA الأول (mRNA) من خلال عملية تُسمَّى النَّسْخ. يَنتُج عن النَّسْخ تتابع من mRNA يحمل المعلومات نفسها الموجودة في DNA للجين، لكنه عبارة عن RNA؛ أيْ إنه يتضمَّن اليوراسيل (U) بدلًا من الثايمين (T). يُمكن بعد ذلك ترجمة تتابع mRNA إلى أحماض أمينية لتكوين عديد ببتيد في عملية تُسمَّى الترجمة. ويُمكن أن يُطوَى عديد الببتيد الناتج لتكوين البروتين المقابِل للجين.

لترجمة mRNA إلى بروتين، يتحوَّل تتابع النيوكليوتيدات في mRNA إلى أحماض أمينية باستخدام الشفرة الوراثية. التتابعات المكوَّنة من ثلاث قواعد، التي تُسمَّى الكودونات، تُقابِلها أحماض أمينية محدَّدة. على سبيل المثال، الكودون «GGG» الموجود في صورة mRNA يُشفِّر للحمض الأميني الجلايسين أثناء الترجمة. تُوجَد ثلاث خواصَّ للشفرة الوراثية:

  1.  الشفرة الوراثية متكرِّرة، وهو ما يعني أنه يُمكن ترجمة حمض أميني واحد من كودونات متعدِّدة.
  2.  الكودونات غير متداخِلة، وهو ما يعني أن القاعدة نفسها لا تُستخدَم مرَّتين في تتابع محدَّد. ولذا فإن GGGUAA يُناظِر GGG UAA، ولن يتكرَّر من القاعدة G الثانية (أيْ لا يُناظِر GGG GGU GUA).
  3.  الشفرة الوراثية عالَمية، وهو ما يعني أن جميع الكائنات الموجودة على الأرض تَستخدِمها لإنتاج البروتين من mRNA. وهي لا تختصُّ بكائنٍ حيٍّ دون آخَر.

ومن ثَمَّ، الإجابة الصحيحة هي الخيار (ب): فهي مُتكرِّرة، وعالَمية، وغير متداخِلة.

نظرًا لأن الشفرة الوراثية عالَمية، يُمكننا مقارنة تتابعات الأحماض الأمينية للبروتينات بين جميع أشكال الحياة. لمقارنة تتابعات الأحماض الأمينية بين أنواع الكائنات، نُجري مطابَقة التتابعات. ويُمكن بعد ذلك فحْص مطابَقات التتابعات لمعرفة الاختلافات بين الأنواع.

على سبيل المثال، يُمكن مُطابقة تتابع البروتين للإنسولين لتوضيح أوجُه التشابُه والاختلاف بين الدجاج، والبشر، والشمبانزي. عادةً ما تقع تتابعات البروتين المتماثِلة في مناطق أساسية بالنسبة إلى وظيفة البروتين، وهذا من شأنه أن يُعطينا لمحةً عن كيفية عمل البروتين. يُمكننا كذلك استخدام هذه المعلومات لمعرفة المزيد عن كيفية تطوُّر البروتينات، أو تغيُّرها بمرور الزمن، وهو ما يُمكننا توسيع نطاقه ليشمل إيجاد العلاقات التطوُّرية بين الكائنات.

يوضِّح الشكل 6 مُطابَقة تتابع الأحماض الأمينية للإنسولين في الدجاج والبشر والشمبانزي لمقارنتها. يُمكننا من خلال مطابَقة هذه البروتينات أن نحدِّد مواضع الفروق، وكلما زادت الفروق بينها، قلَّت صِلة القرابة بين الكائنين. لاحِظ كيف يتشابَه الإنسولين بين الإنسان والشمبانزي (يُوجَد حمض أميني واحد فقط مختلف) مقارنة ببروتين الإنسولين في الدجاجة (حيث تختلف 10 أحماض أمينية تقريبًا). بناءً على ذلك، يَستنتِج العلماء أن الطيور تربطها بنا صِلة قرابة بعيدة مقارنة بالشمبانزي؛ ذلك لوجود فروق (طفرات) أكبر في إنسولين الدجاج مقارنة بإنسولين الشمبانزي. ويرجع ذلك إلى أن الطفرات تَحدُث على مدار فترة زمنية طويلة.

لنلخِّص بعض النقاط الرئيسية التي تناوَلناها في هذا الشارح.

النقاط الرئيسية

  •  تتمثَّل الفكرة المحورية لعلم البيولوجيا الجزيئية في نَسْخ DNA إلى mRNA، الذي يُترجَم بعد ذلك إلى بروتين.
  •  ينقسم تتابع mRNA إلى كودونات تُقابِلها أحماض أمينية محدَّدة بناءً على الشفرة الوراثية.
  •  الشفرة الوراثية غير متداخِلة، وتُقرَأ في تتابعات من ثلاث نيوكليوتيدات، وهي متكرِّرة.
  •  الشفرة الوراثية عالَمية؛ حيث تَتشارَكها جميع أشكال الحياة على الأرض؛ ولذلك يُمكن إجراء مُطابقات لتتابعات البروتينات من أجل توضيح التغيُّرات عبر الزمن التطوُّري.

تستخدم نجوى ملفات تعريف الارتباط لضمان حصولك على أفضل تجربة على موقعنا. معرفة المزيد حول سياسة الخصوصية لدينا.